Review



tr recombinant human rage fc protein r d systems  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    R&D Systems tr recombinant human rage fc protein r d systems
    Tr Recombinant Human Rage Fc Protein R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+human+rage+fc+protein+r+d+systems/Recombinant+Mouse+TLR2+Fc+Chimera+Protein%2C+CF/pm34525359-156-145-150
    Average 93 stars, based on 15 article reviews
    tr recombinant human rage fc protein r d systems - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: TREM2 Is a Receptor for β-Amyloid that Mediates Microglial Function.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Ab1-12 (B436) (Huang et al., 2016) N/A Rabbit anti-human TREM2 Cell Signaling Technology Cat# 91068 RRID:AB_2721119 Goat anti-human TREM2 R&D Systems Cat# AF1828 RRID:AB_2208689 Sheep anti-mouse TREM2 R&D Systems Cat# AF1729 RRID:AB_354956) Mouse anti-Myc Thermo Fisher Scientific Cat# 13-2500 RRID:AB_2533008 Mouse anti-Gas6 Santa Cruz Biotechnology Cat# sc-376087 RRID:AB_10989223 Rabbit anti-phospho-SYK Thermo Fisher Scientific Cat# MA5-14918 RRID:AB_10989513 Rabbit anti-SYK Cell Signaling Technology Cat# 13198 RRID:AB_2687924 Rabbit anti-DAP12 Cell Signaling Technology Cat# 12492 RRID:AB_2721120 Mouse anti-b-actin Sigma Cat# A2228 RRID:AB_476697 Mouse anti-LAMP1 Santa Cruz Biotechnology Cat# sc-20011 RRID:AB_626853 Rabbit anti-phospho-GSK3b Cell Signaling Technology Cat# 5558 RRID:AB_10013750 Rabbit anti-GSK3b Cell Signaling Technology Cat# 12456 RRID:AB_2636978 Rabbit anti-PCNA Cell Signaling Technology Cat# 13110 RRID:AB_2636979 Rabbit anti-cleaved-caspase 3 Cell Signaling Technology Cat# 9664 RRID:AB_2070042 Goat anti-IBA1 Abcam Cat# ab5076 RRID:AB_2224402 Anti-Ab antibody MOAB-2 Biosensis Cat# M-1586-100 RRID:AB_2492497 Biological Samples For patient information, see Table S1 N/A Chemicals, Peptides, and Recombinant Proteins MG132 EMD Millipore Cat# 474790 Chloroquine Cell Signaling Technology Cat# 14774 Margatoxin Alomone Labs Cat# STM-325 Tertiapin Alomone Labs Cat# STT-250 Ab1-42 peptides Anaspec Cat# AS-20276 Biotin-Ab1-42 peptides Anaspec Cat# AS-23523 FAM-Ab1-42 peptides Anaspec Cat# AS-23525 Recombinant human IgG1 Fc R&D Systems Cat# 110-HG Recombinant human TREM2-Fc protein R&D Systems Cat# 1828-T2 Recombinant human TREM1-Fc protein R&D Systems Cat# 1278-TR Recombinant human CD36-Fc protein R&D Systems Cat# 1955-CD Recombinant human RAGE-Fc protein R&D Systems Cat# 1145-RG Recombinant human Gas6 protein R&D Systems Cat# 885-GSB Recombinant human MerTK-Fc protein R&D Systems Cat# 891-MR Recombinant human TREM2-His protein Sino Biological Cat# 11084-H08H Recombinant human TREM1-His protein Sino Biological Cat# 10511-H08H Critical Commercial Assays Human Ab1-42 ELISA kit Thermo Fisher Scientific Cat# KHB3441 Dynabeads protein G Thermo Fisher Scientific Cat# 10004D QuikChange II Site-Directed Mutagenesis kit Agilent Technologies Cat# 200523 Lipojet SignaGen Laboratories Cat# SL100468 (Continued on next page) e1 Neuron 97, 1023–1031.e1–e7, March 7, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines BV2 KCB Cat# KCB 200770YJ RRID:CVCL_0182 BV2 overexpressing TREM2 This paper N/A HEK293T ATCC Cat# CRL-3216 RRID:CVCL_0063 Experimental Models: Organisms/Strains C57BL/6N Jackson Laboratories Cat# 005304 RRID:IMSR_JAX:005304 TREM2 KO mouse John Fryer (Atagi et al., 2015) Cat# KOMP:VG10093 RRID:IMSR_KOMP: VG10093 TgCRND8 mouse Peter St. George-Hyslop (Chishti et al., 2001) N/A Oligonucleotides TREM2 PCR primer, forward (AGGGCCCATGCCAGCGTGTGGT) Integrated DNA Technologies N/A TREM2 PCR primer, reverse (CCAGAGATCTCCAGCATC) Integrated DNA Technologies N/A GAPDH PCR primer, forward (CCCTTCATTGACCTCAACTA) Integrated DNA Technologies N/A GAPDH PCR primer, reverse (CCTTCTCCATGGTGGTGAA) Integrated DNA Technologies N/A IL-6 PCR primer, forward (TAGTCCTTCCTACCCCAATTTCC) Integrated DNA Technologies N/A IL-6 PCR primer, reverse (TTGGTCCTTAGCCACTCCTTC) Integrated DNA Technologies N/A MIP-1a PCR primer, forward (CCCAGCCAGGTGTCATTTTCC) Integrated DNA Technologies N/A MIP-1a PCR primer, reverse (GCATTCAGTTCCAGGTCAGTG) Integrated DNA Technologies N/A Arg1 PCR primer, forward (CACAGTCTGGCAGTTGGAAGC) Integrated DNA Technologies N/A Arg1 PCR primer, reverse (CTTTGGCAGATATGCAGGGAG) Integrated DNA Technologies N/A Recombinant DNA Lentiviral pReceiver-Lv228 vector GeneCopoeia EX-NEG-Lv228 Lentiviral pReceiver-Lv228-TREM2 vector GeneCopoeia EX-S0483-Lv228 pFUSE-hIgG1-Fc vector InvivoGen Cat# pfuse-hg1fc1 pFUSE-TREM2-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R47H)-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R62H)-hIgG1-Fc vector This paper N/A pEGFP-TREM2-N1 vector This paper N/A pmCherry-DAP12-N1 vector This paper N/A Software and Algorithms Fiji-ImageJ National Inst.

    Enzyme-linked Immunosorbent Assay:

    Article Title: TREM2 Is a Receptor for β-Amyloid that Mediates Microglial Function.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Ab1-12 (B436) (Huang et al., 2016) N/A Rabbit anti-human TREM2 Cell Signaling Technology Cat# 91068 RRID:AB_2721119 Goat anti-human TREM2 R&D Systems Cat# AF1828 RRID:AB_2208689 Sheep anti-mouse TREM2 R&D Systems Cat# AF1729 RRID:AB_354956) Mouse anti-Myc Thermo Fisher Scientific Cat# 13-2500 RRID:AB_2533008 Mouse anti-Gas6 Santa Cruz Biotechnology Cat# sc-376087 RRID:AB_10989223 Rabbit anti-phospho-SYK Thermo Fisher Scientific Cat# MA5-14918 RRID:AB_10989513 Rabbit anti-SYK Cell Signaling Technology Cat# 13198 RRID:AB_2687924 Rabbit anti-DAP12 Cell Signaling Technology Cat# 12492 RRID:AB_2721120 Mouse anti-b-actin Sigma Cat# A2228 RRID:AB_476697 Mouse anti-LAMP1 Santa Cruz Biotechnology Cat# sc-20011 RRID:AB_626853 Rabbit anti-phospho-GSK3b Cell Signaling Technology Cat# 5558 RRID:AB_10013750 Rabbit anti-GSK3b Cell Signaling Technology Cat# 12456 RRID:AB_2636978 Rabbit anti-PCNA Cell Signaling Technology Cat# 13110 RRID:AB_2636979 Rabbit anti-cleaved-caspase 3 Cell Signaling Technology Cat# 9664 RRID:AB_2070042 Goat anti-IBA1 Abcam Cat# ab5076 RRID:AB_2224402 Anti-Ab antibody MOAB-2 Biosensis Cat# M-1586-100 RRID:AB_2492497 Biological Samples For patient information, see Table S1 N/A Chemicals, Peptides, and Recombinant Proteins MG132 EMD Millipore Cat# 474790 Chloroquine Cell Signaling Technology Cat# 14774 Margatoxin Alomone Labs Cat# STM-325 Tertiapin Alomone Labs Cat# STT-250 Ab1-42 peptides Anaspec Cat# AS-20276 Biotin-Ab1-42 peptides Anaspec Cat# AS-23523 FAM-Ab1-42 peptides Anaspec Cat# AS-23525 Recombinant human IgG1 Fc R&D Systems Cat# 110-HG Recombinant human TREM2-Fc protein R&D Systems Cat# 1828-T2 Recombinant human TREM1-Fc protein R&D Systems Cat# 1278-TR Recombinant human CD36-Fc protein R&D Systems Cat# 1955-CD Recombinant human RAGE-Fc protein R&D Systems Cat# 1145-RG Recombinant human Gas6 protein R&D Systems Cat# 885-GSB Recombinant human MerTK-Fc protein R&D Systems Cat# 891-MR Recombinant human TREM2-His protein Sino Biological Cat# 11084-H08H Recombinant human TREM1-His protein Sino Biological Cat# 10511-H08H Critical Commercial Assays Human Ab1-42 ELISA kit Thermo Fisher Scientific Cat# KHB3441 Dynabeads protein G Thermo Fisher Scientific Cat# 10004D QuikChange II Site-Directed Mutagenesis kit Agilent Technologies Cat# 200523 Lipojet SignaGen Laboratories Cat# SL100468 (Continued on next page) e1 Neuron 97, 1023–1031.e1–e7, March 7, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines BV2 KCB Cat# KCB 200770YJ RRID:CVCL_0182 BV2 overexpressing TREM2 This paper N/A HEK293T ATCC Cat# CRL-3216 RRID:CVCL_0063 Experimental Models: Organisms/Strains C57BL/6N Jackson Laboratories Cat# 005304 RRID:IMSR_JAX:005304 TREM2 KO mouse John Fryer (Atagi et al., 2015) Cat# KOMP:VG10093 RRID:IMSR_KOMP: VG10093 TgCRND8 mouse Peter St. George-Hyslop (Chishti et al., 2001) N/A Oligonucleotides TREM2 PCR primer, forward (AGGGCCCATGCCAGCGTGTGGT) Integrated DNA Technologies N/A TREM2 PCR primer, reverse (CCAGAGATCTCCAGCATC) Integrated DNA Technologies N/A GAPDH PCR primer, forward (CCCTTCATTGACCTCAACTA) Integrated DNA Technologies N/A GAPDH PCR primer, reverse (CCTTCTCCATGGTGGTGAA) Integrated DNA Technologies N/A IL-6 PCR primer, forward (TAGTCCTTCCTACCCCAATTTCC) Integrated DNA Technologies N/A IL-6 PCR primer, reverse (TTGGTCCTTAGCCACTCCTTC) Integrated DNA Technologies N/A MIP-1a PCR primer, forward (CCCAGCCAGGTGTCATTTTCC) Integrated DNA Technologies N/A MIP-1a PCR primer, reverse (GCATTCAGTTCCAGGTCAGTG) Integrated DNA Technologies N/A Arg1 PCR primer, forward (CACAGTCTGGCAGTTGGAAGC) Integrated DNA Technologies N/A Arg1 PCR primer, reverse (CTTTGGCAGATATGCAGGGAG) Integrated DNA Technologies N/A Recombinant DNA Lentiviral pReceiver-Lv228 vector GeneCopoeia EX-NEG-Lv228 Lentiviral pReceiver-Lv228-TREM2 vector GeneCopoeia EX-S0483-Lv228 pFUSE-hIgG1-Fc vector InvivoGen Cat# pfuse-hg1fc1 pFUSE-TREM2-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R47H)-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R62H)-hIgG1-Fc vector This paper N/A pEGFP-TREM2-N1 vector This paper N/A pmCherry-DAP12-N1 vector This paper N/A Software and Algorithms Fiji-ImageJ National Inst.

    Mutagenesis:

    Article Title: TREM2 Is a Receptor for β-Amyloid that Mediates Microglial Function.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Ab1-12 (B436) (Huang et al., 2016) N/A Rabbit anti-human TREM2 Cell Signaling Technology Cat# 91068 RRID:AB_2721119 Goat anti-human TREM2 R&D Systems Cat# AF1828 RRID:AB_2208689 Sheep anti-mouse TREM2 R&D Systems Cat# AF1729 RRID:AB_354956) Mouse anti-Myc Thermo Fisher Scientific Cat# 13-2500 RRID:AB_2533008 Mouse anti-Gas6 Santa Cruz Biotechnology Cat# sc-376087 RRID:AB_10989223 Rabbit anti-phospho-SYK Thermo Fisher Scientific Cat# MA5-14918 RRID:AB_10989513 Rabbit anti-SYK Cell Signaling Technology Cat# 13198 RRID:AB_2687924 Rabbit anti-DAP12 Cell Signaling Technology Cat# 12492 RRID:AB_2721120 Mouse anti-b-actin Sigma Cat# A2228 RRID:AB_476697 Mouse anti-LAMP1 Santa Cruz Biotechnology Cat# sc-20011 RRID:AB_626853 Rabbit anti-phospho-GSK3b Cell Signaling Technology Cat# 5558 RRID:AB_10013750 Rabbit anti-GSK3b Cell Signaling Technology Cat# 12456 RRID:AB_2636978 Rabbit anti-PCNA Cell Signaling Technology Cat# 13110 RRID:AB_2636979 Rabbit anti-cleaved-caspase 3 Cell Signaling Technology Cat# 9664 RRID:AB_2070042 Goat anti-IBA1 Abcam Cat# ab5076 RRID:AB_2224402 Anti-Ab antibody MOAB-2 Biosensis Cat# M-1586-100 RRID:AB_2492497 Biological Samples For patient information, see Table S1 N/A Chemicals, Peptides, and Recombinant Proteins MG132 EMD Millipore Cat# 474790 Chloroquine Cell Signaling Technology Cat# 14774 Margatoxin Alomone Labs Cat# STM-325 Tertiapin Alomone Labs Cat# STT-250 Ab1-42 peptides Anaspec Cat# AS-20276 Biotin-Ab1-42 peptides Anaspec Cat# AS-23523 FAM-Ab1-42 peptides Anaspec Cat# AS-23525 Recombinant human IgG1 Fc R&D Systems Cat# 110-HG Recombinant human TREM2-Fc protein R&D Systems Cat# 1828-T2 Recombinant human TREM1-Fc protein R&D Systems Cat# 1278-TR Recombinant human CD36-Fc protein R&D Systems Cat# 1955-CD Recombinant human RAGE-Fc protein R&D Systems Cat# 1145-RG Recombinant human Gas6 protein R&D Systems Cat# 885-GSB Recombinant human MerTK-Fc protein R&D Systems Cat# 891-MR Recombinant human TREM2-His protein Sino Biological Cat# 11084-H08H Recombinant human TREM1-His protein Sino Biological Cat# 10511-H08H Critical Commercial Assays Human Ab1-42 ELISA kit Thermo Fisher Scientific Cat# KHB3441 Dynabeads protein G Thermo Fisher Scientific Cat# 10004D QuikChange II Site-Directed Mutagenesis kit Agilent Technologies Cat# 200523 Lipojet SignaGen Laboratories Cat# SL100468 (Continued on next page) e1 Neuron 97, 1023–1031.e1–e7, March 7, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines BV2 KCB Cat# KCB 200770YJ RRID:CVCL_0182 BV2 overexpressing TREM2 This paper N/A HEK293T ATCC Cat# CRL-3216 RRID:CVCL_0063 Experimental Models: Organisms/Strains C57BL/6N Jackson Laboratories Cat# 005304 RRID:IMSR_JAX:005304 TREM2 KO mouse John Fryer (Atagi et al., 2015) Cat# KOMP:VG10093 RRID:IMSR_KOMP: VG10093 TgCRND8 mouse Peter St. George-Hyslop (Chishti et al., 2001) N/A Oligonucleotides TREM2 PCR primer, forward (AGGGCCCATGCCAGCGTGTGGT) Integrated DNA Technologies N/A TREM2 PCR primer, reverse (CCAGAGATCTCCAGCATC) Integrated DNA Technologies N/A GAPDH PCR primer, forward (CCCTTCATTGACCTCAACTA) Integrated DNA Technologies N/A GAPDH PCR primer, reverse (CCTTCTCCATGGTGGTGAA) Integrated DNA Technologies N/A IL-6 PCR primer, forward (TAGTCCTTCCTACCCCAATTTCC) Integrated DNA Technologies N/A IL-6 PCR primer, reverse (TTGGTCCTTAGCCACTCCTTC) Integrated DNA Technologies N/A MIP-1a PCR primer, forward (CCCAGCCAGGTGTCATTTTCC) Integrated DNA Technologies N/A MIP-1a PCR primer, reverse (GCATTCAGTTCCAGGTCAGTG) Integrated DNA Technologies N/A Arg1 PCR primer, forward (CACAGTCTGGCAGTTGGAAGC) Integrated DNA Technologies N/A Arg1 PCR primer, reverse (CTTTGGCAGATATGCAGGGAG) Integrated DNA Technologies N/A Recombinant DNA Lentiviral pReceiver-Lv228 vector GeneCopoeia EX-NEG-Lv228 Lentiviral pReceiver-Lv228-TREM2 vector GeneCopoeia EX-S0483-Lv228 pFUSE-hIgG1-Fc vector InvivoGen Cat# pfuse-hg1fc1 pFUSE-TREM2-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R47H)-hIgG1-Fc vector This paper N/A pFUSE-TREM2(R62H)-hIgG1-Fc vector This paper N/A pEGFP-TREM2-N1 vector This paper N/A pmCherry-DAP12-N1 vector This paper N/A Software and Algorithms Fiji-ImageJ National Inst.



    Similar Products

    tr recombinant human rage fc protein r d systems  (R&D Systems)
    93
    R&D Systems tr recombinant human rage fc protein r d systems
    Tr Recombinant Human Rage Fc Protein R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+human+rage+fc+protein+r+d+systems/Recombinant+Mouse+TLR2+Fc+Chimera+Protein%2C+CF/pm34525359-156-145-150
    Average 93 stars, based on 1 article reviews
    tr recombinant human rage fc protein r d systems - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    rg recombinant human gas6 protein r d systems  (R&D Systems)
    94
    R&D Systems rg recombinant human gas6 protein r d systems
    Rg Recombinant Human Gas6 Protein R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+human+rage+fc+protein+r+d+systems/Recombinant+Human+RAGE+Fc+Chimera+Protein%2C+CF/pm29518356-102-228-233
    Average 94 stars, based on 1 article reviews
    rg recombinant human gas6 protein r d systems - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    recombinant human rage fc protein r d systems  (R&D Systems)
    94
    R&D Systems recombinant human rage fc protein r d systems
    Recombinant Human Rage Fc Protein R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+human+rage+fc+protein+r+d+systems/Recombinant+Human+CD36%2FSR-B3+Fc+Chimera+Protein%2C+CF/pm29518356-102-221-225
    Average 94 stars, based on 1 article reviews
    recombinant human rage fc protein r d systems - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    rage human igg1 fc chimeric protein manufactured by r d systems  (R&D Systems)
    96
    R&D Systems rage human igg1 fc chimeric protein manufactured by r d systems
    Rage Human Igg1 Fc Chimeric Protein Manufactured By R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+human+rage+fc+protein+r+d+systems/Recombinant+Human+IgG1+Fc+Protein%2C+CF/us08501914-483-12-19
    Average 96 stars, based on 1 article reviews
    rage human igg1 fc chimeric protein manufactured by r d systems - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results